2009英文摘要

发布日期: 2010-01-06 【关闭】


Acta Laboratorium Animalis Scientia Sinica
2009
Vol.17 No.1-6



Establishment of a Pulmonary Metastasis Model of Human Melanoma in Nude Mice
ZHANG Yong-ci, ZHOU Yuan, YANG Ming, FAN Dong-mei, XIONG Dong-sheng, YANG Chun-zheng
(State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, 288 Nanjing Road, Tianjin 300020,. China)
【Abstract】Objective To establish a pulmonary metastasis model of integrin αvβ3-positive human melanoma in nude mice, and identify the differences between the melanoma cells and its pulmonary metastatic cells. Methods 1×106, 2×106, and 5×106 human melanoma M21 cells were injected into the tail vein of nude mice of different groups, respectively. The mice were sacrificed before spontaneous death, or on the 50th day after injection of M21 cells. The white metastatic foci on the surface of the lung were counted after fixed in Bouin’s fixative solution. The lung and other organs were sent for pathological examination. Real-time PCR and gelatin zymography were carried out to identify the differences of integrin αvβ3 and MMP-2 between the melanoma cells and its pulmonary metastatic foci cells. Results Each mouse in the M21 cell injection groups had metastatic foci in the lung. The number of white metastatic foci were 84±8,70±6,88±12 after injection of 1×106, 2×106, and 5×106 M21 cells, respectively. Differences between the three groups were statistically not significant. Organs of negative control group had no metastatic foci. The pulmonary metastatic cells had higher activity of MMP-2 (2.76-fold), and higher mRNA level of integrin αv and β3 subunit (1.8- and 3.0-fold, respectively), compared with the parent M21 cells. The doubling time of the former was 23.4 h, while the latter was 34.7 h. Conclusion A pulmonary metastasis model of M21 in nude mice has been established successfully. This method is practical, reliable, easy to manipulate and only 1×106 melanoma cells and 50 days are needed. The establishment of the pulmonary metastasis model of the integrin αvβ3-positive human melanoma will benefit the related research both on melanoma and integrin αvβ3.
[Key words] Melanoma; Pulmonary metastasis; Integrin αvβ3; Nude mouse
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.1: 1--4



Effect of 5-Fluorouracil in Delayed-Release PLGA-Microspheres
on Colorectal Cancer Xenograft in Nude Mice
LI Jing-quan1, LI Rong1, XU Ying-xin1 ,WANG Shi-liang2
(1. Chinese PLA general hospital, Beijing 100853 China; 2. Control release Laboratory,Hefei University of Technology , HeFei 230009 China)
[Abstract] Objective To study the antitumor effect of peri-tumor implantation of delayed-release PLGA-5-Fluorouracil microsphere on xenograft colorectal tumor in mice. Method 60 tumor-bearing nude mice were randomly divided into six groups, group A and B were treated with peri-tumoral implantation of PLGA-5-Fluorouracil microsphere, the dose of 5-Fluorouracil were 200mg/kg and 100mg/kg respectively, group C and D treated with peri-tumor injection of 5-Fluorouracil solution, the dose of 5-Fluorouracil were 200mg/kg and 100mg/kg respectively, group E treated with PLGA microsphere, the dose was 800mg/kg, group F did not receive any treatment. On the days of 0, 3, 6, 9,12 and 15, health condition and body mass was weighed, the size of the tumor were observed. At the end of the experiment, the weight of the tumor was measured and tumor inhibiting rate was calculated, the growth curve was drew, blood were draw for white cell count and liver, renal function test. Results The growth curve were mild in group A and B and sharp in group C, D, E and F. there were statistical difference of the tumor volume between Group A, B and other groups, there were no statistical difference of the tumor volume between group C, D, E and F. Tumor inhibiting rate of group A and B were 75% and 62% respectively, there were statistical differences between A, B and C, D . The weight change before and after treatment between group A, B, C , D , E and F had no statistical differences. White cell count, liver and renal function test were normal in all groups.Conclusion Delayed-release of PLGA-5-Fluorouracil microsphere can effectively restrain the tumor growth and has no evidently side effects.
[Key words] Nude mice;Colorectal cancer;5-Fluorouracil;Delayed-release;
Microsphere
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.2: 81-84


The Immuno-Modulating Effect of Qi-Hong Capsule in the Treatment of Mouse Models of Viral Myocarditis Infected with Coxsackievirus B3
SONG Xiao-dong, XIN Yin, LIU Zheg, WANG Xiao-jian, WANG Hu, CHEN Jing-zhou, ZHANG Chan-na, HUI Ru-tai
Key Laboratory of Clinical Cardiovascular Genetics, Ministry of Education (Sino-German Laboratory for Molecular Medicine), Fu Wai Hospital, PUMC& CAMS, Beijing 100037,China
[Abstract] Objective To investigate whether the traditional Chinese Medicine Qi-Hong capsule has antiviral effect on the treatment of viral myocarditis in mice via modulating the immune system. Methods Male Balb/C mice were enrolled in this experiment and divided into 6 groups: normal control, sham control, mice treated with Ribavirin, mice treated with Qi-Hong capsule at three different concentrations. The mice were inoculated intraperitoneally with 10-3 TCID50 CVB3 virus suspension to simulate viral myoicarditis, and detected the immunological indexes on 3, 6, 9, 12 and 15d, including LDH, CK-MB, IFN and neutralizing antibodies. Lastly, the hearts were taken out and preparated into suspension to determine the titer of CVB3. Results Qi-Hong capsules significantly decreased the concentration of CK-MB and LDH in the mouse serum (P<0.05) and presented a dose-dependent response relationship, illuminating that Qi-Hong capsules could alleviate the cardiomyocyte lysis. The data of the IFN titer indicated that Qi-Hong capsules had strong ability to enhance the expression of IFN. In addition, Qi-Hong capsules could increase the content of neutralizaing antibodies in the mouse serum. The results of determination of the titer of CVB3 in cardiomyocyte suspension showed that Qi-Hong capsules could significantly inhibit the replication of CVB3 virus (P<0.05) at different times. Conclusion Qi-Hong capsules may protect the mouse heart infected with CVB3. The mechanism of this effect may be related to the modulation activity in immune system.
[Keyword] Myocarditis; Qi-Hong capsule

Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.2: 85-89


Establishment and Evaluation of a Rabbit Model of Aortic Atherosclerosis Vulnerable Plaque
ZHANG Jun-ping1, PENG Li2, LI Liang-jun2, LI Ming2, XU Ying-zhi2, YANG Cui2, ZHOU Ya-nan2, ZHANG Guang-yin2
(1. The First Affiliated Hospital of Tianjin University of Traditional Chinese Medicine, Tianjin 300193, China; 2. Tianjin University of Traditional Chinese Medicine,Tianjin 300193, China)
[Abstract] Background It was the leading pathological foundation of acute coronary syndrome (ACS) that Atherosclerotic(AS) stable plaque develops into vulnerable plaque (VP) and then accompanied by thrombosis. Recently, the research of VP has become a hotspot in cardiovascular disease studies, and the animal model of vulnerable plaque is a critical problem. Therefore, it’s important to establish an ideal animal model of VP. Various factors are believed to be related to the development of VP, such as mechanical forces, blood lipid and active inflammation, etc. In the past years, a lot of scholars at home and abroad had done their best on the problem, such as the ApoE deficient mice model, gene transfection rabbits model, etc. However, the recognized and reliable VP model hadn’t taken shape so far. It was reported that hypercholesterolemia and acute immune injury promoted the formation of early atherosclerosis lesions cooperatively. Objective This study intended to explore a method of establishing the aorta vulnerable plaque model in rabbits, similar to that in human body, and its characterization.
Methods Twenty-four male Japanese white rabbits aged 2 months with the weight of 2.0±0.2 kg were purchased from Bei Jin Vital River Laboratory Animal Technology Co., Ltd. All the rabbits were fed for 1 week and then divided into two groups: the control group (8 animals) and the experimental group (16 animals). Rabbits in the control group were given normal feed, while rabbits in the experimental group were given a diet containing 1% cholesterol 100g/d (including 1% cholesterol, 5% lard, 5% egg yolk and 89% normal feed) from the first week to the tenth week, and injected bovine serum albumin (BSA) 250 mg/kg once via the ear marginal vein at the second week, and then underwent balloon-induced aortic wall injury via the femoral artery at the fourth week. All the rabbits drink water freely. Total cholesterol (TC), triglyceride (TG), Low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), oxidized low density lipoprotein (ox-LDL), tumor necrosis factor-α (TNF-α), interleukin-l (IL-l) and interleukin-l0 (IL-l0) were tested at 0, 3rd, 6th and 10th week. Histopathological examination and NF-κBp65 subunit immunohistochemical analysis of the aorta were performed at the end of the experiment. The ratio of area of plaque/intima (PA/IA), the ratio of area of lipid core/plaque (LCA/PA), the ratio of thickness of fibrous cap/ intima-media (FCT/IMT) and the ratio of NF-κB p65 subunit positive area were assessed and calculated by a 2000-high-definition colorful pathology imaging analysis system.
Results 8 rabbits died during the experiment in all, including 2 rabbits in the control group and 6 rabbits in the experimental group. The body weight of the two groups showed an upward trend over time. However, there was no statistically significant difference between the two groups ( P>0.05). Serum TC, LDL-C, HDL-C, TC/HDL-C, LDL-C/HDL-C in the experimental group showed an upward trend over time except TG, and there was a significant difference in comparison with those in control group at 3, 6 and 10 weeks ( P<0.01). At the end of experiment, serum TC and LDL-C reached (24.043±4.725) mmol/L and (11.730±3.090) mmol/L, respectively. Serum ox-LDL in the experimental group was 8 times higher than that in the control group at 10th week. Moreover, TNF-α, IL-l, IL-l0 at 10th week were 3.4, 4, 4.7 times higher, respectively, than those at 0 week in the experimental group, and the ascending IL-l0 did not show the same extent as TNF-α, IL-l at 3rd week. In the experimental group, PA/IA was (53.6±10.5)%, LCA/PA was (54.9±9.4)%, FCT/IMT was (8.5±4.2)%, and the ratio of NF-κBp65 subunit positive area was (16.2±4.6)% , which was 13.5 times higher than that in the control group.
Conclusions A rabbit model of aortic atherosclerosis vulnerable plaque has been successfully established by combination of high cholesterol diet, bovine serum albumin injection and balloon injury. This model showing typical hyperlipemia, active inflammation in the atherosclerotic plaque area, and similar morphological changes to those in human vulnerable plaque, may serve as an useful tool in research on atherosclerosis.
【Key words】:Atherosclerosis; Vulnerable plaque; Rabbit model; Balloon pull; Bovine serum albumin

Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.3: 161-165

Comparison of the Pathogenesis of Experimental Autoimmune Encephalomyelitis in Sprague-Dawley and Wistar Rats
ZHU Ying-biao, LI Xiao-li, TONG Qiao-wen, XIA Nian-ge, YAO Su-qin, LI Zheng-zheng, ZHENG Rong-yuan
(Department of Neurology, the First Affiliated Hospital and Research Institute of Experimental Neurobiology, Wenzhou Medical College, Wenzhou 325000, China)
[Abstract] Objective To compare the development rule and inflammatory response of experimental autoimmune encephalomyelitis (EAE), an animal model of autoimmune disease multiple sclerosis, in Sprague-Dawley (SD) rats and Wistar rats. Methods Twelve adult female Wistar rats and SD rats were utilized for the present experiments. The EAE model was induced by injecting emulsified spinal cord homogenate of guinea-pig (GPSCH) with complete Freud`s adjuvant (CFA) and intraperitoneal injecting Bordetella pertussis vaccine. after immunization the rats were weighed and evaluated twice daily for clinical signs of EAE. At the acute phase of EAE, EAE-suffering rats which got a maximal clinical scores were euthanized and samples of nervous tissue from different sites were dissected for assessing the degree of inflammatory infiltration. The clinical symptoms and pathological changes of central nervous system were compared between the two strains of rats. Results Most of the Wistar and SD rats (9/12 and 11/12 respectively) injected with GPSCH developed typical EAE and got serious clinical symptoms during the peak-time of disease. Just as expected, the body weight of EAE-suffering rats descended rapidly as clinical signs became severe. The differences of incidence between the two strains of rats showed to be statistically not significant (P>0.05). Interestingly, the latency and peak time of EAE in SD rats were longer (15.88±0.64d, P<0.01 and 18.63±1.52d, P<0.05, respectively) and the maximal clinical score in SD rats was higher (3.13±1.89, P<0.05) compared with those in Wistar rats. The pathological examination showed that brainstem, in both strains of rats, suffered the most severe lesions among all sites of CNS, but cerebrum got the slightest nervous damage. Significant inflammatory infiltration of mononuclear cells, confluent demyelination around inflammatory cells and the typical perivascular cuffing were observed in brainstem of these EAE-suffering animals. Consistent with the differences of clinical signs between the two strains of rats, the nervous inflammatory lesions of CNS in SD rats were more serious (2.83±1.48 as standard pahological score, P<0.05) than that in Wistar rats, in general. A statistically significant positive correlation between the clinical score and the standard pathological score is apparent from Spearman's rho values (γ = 0.714,P <0.05 for Wistar rats; γ = 0.680,P <0.05 for SD rats), reflecting the validity of the pathological score. Conclusion The development of EAE and the inflammatory response are most serious in brainstem, and similar between the two strains of rats. However, in SD rats, the maximal clinical score is higher, and the inflammatory response is more serious than that in Wistar rats. It is concluded that SD rats are also ideal animals for re-establishing EAE model, and are the more suitable animals for exploring the pathologic mechanism of EAE than SD rats.
[Key words] Experimental autoimmune encephalomyelitis;Animal model;Wistar rats;Sprague-Dawley rats
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.3: 166-171


Establishment and Assessment of an Experimental Rat Model of Type2 Diabetic Cardiomyopathy
DONG Shi-fen, HONG Ying*, FAN Jiang-bo,YU Hai-shi, HE Rui-jie
Department of Traditional Chinese Medicine Pharmacology, School of Chinese Pharmacology, Beijing University of Chinese Medicine, Beijing,100102,China

【Abstract】Objective Diabetic cardiomyopathy (DC) is an independent and specific diabetic complication occurred in the absence of coronary artery disease or systemic hypertension. Epidemiological and clinical studies have demonstrated the existence of a diabetic cardiomyopathy in humans. As a clinical condition, DC diagnosed when ventricular dysfunction develops in patients with diabetes in the absence of coronary atherosclerosis and hypertension and often occurred as an unknown asymptomatic heart disease, which is obstacle for clinical diagnosis and treatment. One major impediment to progress in this area is the lack of appropriate animal models, and a related difficulty is the lack of standardized measures for phenotypes associated with diabetes and its complications. It is important to bear in mind that the establishment of DC animal models must reflect the clinical features of DC patients and fulfill the definition of diabetic cardiomyopathy before the start of mechanism and medical studies. The aim of this study was to establish and assess an experimental rat model of type 2 diabetic cardiomyopathy (DC), and to evaluate the contribution of high sucrose and high fat diet to the pathology and find easy and stable indexes of DC assessment.
Methods 45 male Wistar rats (150 g~180 g) were randomly divided into 3 groups: the control group, high sucrose-high fat group (HSF) and high sucrose-high fat with low dose streptozotocin (STZ) group (HSF-STZ). The rats in the control group were fed with normal food, the HSF and HSF-STZ rats were fed with high sucrose-high fat diet (consisted of 20% sucrose, 10% lard, 2.5% cholesterol and 67.5% normal food) for totally 11 weeks. Blood of all rats were collected after 12-hour fasting to measure fasting blood glucose (FBG), total cholesterol (TCH) and triglyceride (TG) before high sucrose–high fat diet feeding and after 4 weeks (the fifth week) of feeding. Then the rats in HSF-STZ group were injected intraperitoneally (ip) with single 30 mg/kg STZ (resolved in citric acid-sodium citrate buffer, pH = 4.5) after 4 weeks’ high sucrose-high fat diet feeding. FBG were tested after 72 hours and FBG ≥11.1 mmol/L was considered as the standard for the establishment of diabetes mellitus. Rats in control and HSF groups were injected i.p. with citric acid-sodium citrate buffer (pH = 4.5). At the end of experiment (the eleventh week), heart rate (HR), stroke volume (SV) and cardiac output (CO) of the rats were measured by impedance plethysmography (IPG) and left ventricular systolic pressure (LVSP), left ventricular end diastolic pressure (LVEDP), the maximum rate of myocardial contraction (+dP/dt max) and the maximum rate of myocardial diastole (-dP/dt max) were measured by left ventricular catheterization using MP150 polygraph physiological signal recorder to evaluate cardiac function. Then artery blood of the rats were collected to measure FBG, glycosylated hemoglobin (GHb), glycosylated serum protein (GSP), TCH, nonesterified fatty acid (NEFA) and high density lipoprotein (HDL).
Results 1. The effect of high sucrose and high fat fodder on rats. Among the three groups, blood glucose and lipid were similar to each other at the beginning of the experiment. After 4 weeks of high sucrose-high fat diet feeding in rats, serum TCH and TG in HSF and HSF-STZ groups were significantly increased in comparrison with those the control group (2.4±0.4, 2.2±0.3 vs 1.9±0.2; 0.75±0.17, 0.89±0.28 vs. 0.56±0.12; P<0.05, P<0.05), but fasting blood glucose (FBG) didn’t show a significant difference (5.0±1.2 , 4.3±0.8 vs. 4.8±1.8; P>0.05).
2. The changes of glucose metabolism after high sucrose and high fat diet with STZ injection in rats. The FBG of rats in HSF-STZ group significantly increased at 72 hours after STZ injection as well as GHb and GSP of rats in HSF-STZ group were significantly higher than the values of the control group (18±8, 35.5±9.7, 1.8±0.4 vs. 5.4±0.8, 26.2±8.9, 1.4±0.2; P<0.001, P<0.05, P<0.05) indicating a sustained hyperglycemia level after STZ injection. But values of blood glucose were not significantly increased in the rats of HSF group (5.2±1.0, 25.9±6.5 ,1.2±0.3 vs. 5.4±0.8, 26.2±8.9 , 1.4±0.2; P>0.05).
3. The changes of lipid metabolism after high sucrose and high fat feeding with STZ injection in rats .The blood lipid maintained a high level after another 6 weeks of high sucrose-high fat diet feeding. Plasma NEFA in HSF and HSF-STZ groups were significantly increased in comparrison with those of control group (0.74±0.33, 0.64±0.24 vs. 0.32±0.19; P<0.05, P<0.05), and HDL was significantly lower (0.72±0.17, 0.87±0.26 vs. 1.18±0.29; P<0.001, P<0.05). TCH of rats in HSF-STZ group was significantly higher than that of the control rats(2.6±1.0 vs. 1.8±0.6; P<0.05), whereas the HSF rats didn’t show significant difference (2.0±0.6 vs. 1.8±0.6; P>0.05).
4. The changes of cardiac function after high sucrose and high fat diet feeding with STZ injection in rats. After 11 weeks of high sucrose-high fat diet feeding, mild cardiac dysfunction was found in the rats of HSF group. The LVSP was lower than thaty of the control group (161±22 vs. 184±22; P<0.05) and LVEDP was higher (-8.6±1.8 vs. -15.2±6.8; P<0.05). But ±dP/dtmax, HR, SV and CO showed no significant differences (15460±5680, -12,110±5,170, 426±47, 0.035±0.010, 10.9±2.8 vs. 19280±4170, -15,230±2,848, 435±39, 0.033±0.012, 12±4; P>0.05). The rats of HSF-STZ group exhibited cardiac dysfunction, and diastolic dysfunction exhibited more significant. The LVSP, SV and CO in rats of HSF-STZ group were significantly lower (156±23, 0.026±0.006, 9.2±1.4 vs. 184±22, 0.033±0.012, 12±4; P<0.05) than those of the control group while LVEDP and –dP/dtmax were higher (-8.4±3.6, -10,801±2,783 vs. -15.2±6.8, -15,230±2,848 ; P<0.05). But HR didn’t show a significant difference (396±44 vs. 435±39, P>0.05 ).
Discussion and conclusion The development of diabetic cardiomyopathy is multifactorial and its pathogenesis is still under controversial. Recent putative mechanisms include metabolic disturbances (depletion of glucose transporter, increased free fatty acids, carnitine deficiency), abnormalities in ion homeostasis (changes in calcium homeostasis), insulin resistance (hyperinsulinemia and reduced insulin sensitivity), inner fibrosis (associated with increases in angiotensin II, IGF-I, and inflammatory cytokines), small vessel disease (endothelial dysfunction and impaired coronary flow reserve), and autonomic dysfunction. Recent studies have proposed that mechanisms involved in decreasing myocardial contractility including impaired calcium homeostasis, increased oxidative stress, derrangement of substrate metabolism, mitochondrial dysfunction and upregulated renin-angiotensin system. Sustained hyperglycemia may increase glycation of interstitium such as collagen by varies pathways, which also results in myocardial stiffness and impaired contractility.
More and more recent experimental studies have focused on the animal model of DC and present main DC models are as follows: 1. Transgenic animals, such as db/db diabetic mouse, ob/ob obesity mouse, Zucker diabetic fat rats, CIRKO mouse, IRS-1 KO mouse and so on. The heart of these animals exhibits increased rate of myocardial oxygen consumption, increased rate of fatty acid oxidation, decreased myocardial efficiency, mitochondrial dysfunction, myocardial insulin signaling impairment, lipotoxicity, increased oxidative stress and so on, which are similar to the clinical characteristics of DC patients. Although transgenic animals are excellent models for the study of non-insulin-dependent diabetes mellitus and its complications, their applications are limited because of high cost and strict experimental conditions. 2. Simply high-fat feeding-induced animal model. A study has examined the temporal pattern of changes in insulin action and glucose metabolism in individual organs during chronic high-fat feeding in C57BL/6 mice. The mice showed cardiac dysfunction, abnormal metabolism, impaired insulin signaling and decreased cardiac efficiency. But cardiac dysfunction accompanied with mild hyperglycemia and hyperleptinemia occurred after 20 weeks of high-fat feeding. The experiment period of the model was too long and hyperglycemia was not significant, so it is also not a satisfactory DC model for related studies.
Insulin resistance is a clear antecedent of type 2 diabetes on myocardial metabolism and function. Studies in humans with type 2 diabetes or obesity and insulin resistance have demonstrated significant increase in myocardial fatty acid uptake and oxidation as well as reduced concentrations of high-energy phosphates in individuals without coronary artery disease or heart failure. Recent studies have focused on the contribution of impaired insulin signaling or insulin action to the pathogenesis of contractile dysfunction in the diabetic heart. We induced insulin resistance in rats by feeding high sucrose and high fat diet. It showed that TCH and TG significantly increased after 4 weeks of high sucrose and high fat diet feeding which means the onset of dyslidemia. As a kind of pancreatic beta-cell toxin, low dosage of STZ was administrated to induce partly pancreatic dysfunction simulating pancreatic islet cell hypofunction of type 2 DC patients. In this study rats in the HSF-STZ group were injected with 30 mg/kg STZ and fed with the high sucrose and high fat diet. A rat model of DM was established because the rats in HSF-STZ group began to show an increase of blood glucose at 72 h after STZ injection and the blood lipid and glucose maintained a high level during the experiment time. High sucrose and high fat diet can induce dyslipidemia and combined with STZ injection may result in worsen disturbances of lipid and glucose metabolisms, which are similar to that observed in patients with type 2 DM.
Metabolic disturbances play an important role in cardiac dysfunction and pathological changes in DM patients, and are closely related to heart diastolic dysfunction at the early age. Diastolic dysfunction is a characteritic cardiac dysfunction of diabetic cardiomyopathy that may precede the development of systolic dysfunction. LV diastolic dysfunction is characterized by impairment in early diastolic filling, an increase in atrial filling, a prolongation of isovolumetric relaxation and increased numbers of supraventricular premature beats. The measurement of cardiac function of rats in the HSF-STZ group showed that LVSP, SV and CO were significantly increased and LVEDP and -dP/dtmax decreased in comparison with those in the control rats. It indicated that high sucrose and high fat diet with STZ could impair both diastolic and systolic function and diastolic dysfunction exhibited more significantly. While HR showing no significant difference compared with that in the normal rats indicated cardiac dysfunction was mainly induced by direct myocardial contractile dysfunction instead of autonomic neuropathy. The measurement of rats in HSF group which were fed with high sucrose and high fat diet for 11weeks showed mild cardiac dysfunction including decreased LVSP and increased LVEDP. So we got a conclusion that simply high sucrose and high fat diet induction played an important role in metabolic disturbances and cardiac dysfunction.
In summary, experimental type 2 DC model can be established by high sucrose-high fat diet with single low dosage of STZ injection in rats. The rat model of DC can be evaluated efficiently and simply by synthetic indexes of glucose and lipid metabolism and heart function. The model rats demonstrate glucose and lipid metabolism disturbances and cardiac dysfunction, especially diastolic dysfunction is similar to that of clinical symptoms. Time of the establishment of this model is much shorter compared with simple high-fat feeding in rats (11 weeks vs. 20 weeks) and the method is much easier to perform.
【Key words】 Type 2 diabetic cardiomyopathy; Rat model; High sucrose-high fat diet; Streptozotocin
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.4: 245-251


VEGFR-3 gene Transfection for its Soluble VEGFR-3 Release in
Lymphatic Endothelial Progenitor cells
AO Hong, TAN Yu-zhen, WANG Hai-jie, GUO Hai-dong
(Department of Anatomy and Histology and Embryology, Shanghai Medical School of Fudan University,
Shanghai 200032, China)
【Abstract】 Vascular endothelial growth factor receptor 3 (VEGFR-3) a specific receptor of vascular endothelial growth factor C (VEGF-C), is a new member of tyrosine kinase receptor family. VEGFR-3 is consisted of extracellular, transmembrane and intracellular regions. The extracellular region comprises of seven immunoglobin-like domains, among which the first three domains (1-3Ig) play especially important roles in VEGF-C/VEGFR-3 signaling pathway, because these domains are responsible for the binding between VEGFR-3 and VEGF-C, Lymphatic endothelial progenitor cells(LEPCs) are mainly localized to the bone marrow, but can be released from bone marrow into diseased tissues in cases of inflammation, Ischemia or tumour etc, and differentiated into lymphatic endothelial cells (LEC) to participated in the lymphangiogenesis in tumour tissues. As VEGF-C/VEGFR-3 signaling pathway is critical for the differentiation of LEPCs into LEC in tumour tissue, blockage of this signaling pathway will therefore be useful for inhibiting lymphangiogenesis and for the anti-tumour treatment. It is suggested that soluble VEGFR-3 can interfere with the binding between the VEGF-C and membrane-bound VEGFR-3, and thus can block VEGF-C/VEGFR-3 signaling pathway. In this study, we investigate the secretion of soluble VEGFR-3 proteins in LEPCs after transfected with recombinant adenovirus containing VEGFR-3(1-3Ig) gene of BABL/c mouse and the biological activity of the secreted protein. The gene encoding VEGFR-3(1-3Ig) was obtained through nested RT-PCR from BABL/c mouse placental, and human CD33 signal peptide was added to the N-terminal of the PCR product through recombinant PCR technique. Then the gene fragment was cloned into the adenovirus shuttle plasmid pDC316-IRES-EGFP. After confirmed with restriction enzyme digestion and DNA sequencing, the recombinant adenovirus vector carrying VEGFR-3 (1-3Ig) was transfected into 293 cells together with the packing vector to produce the recombinant adenovirus. The recombinant adenovirus was used to transfect LEPCs, and ELISA was employed to quantify the amount of soluble VEGFR-3 protein in the cultural medium from transfected LEPCs, The biological activity of the soluble VEGFR-3 was determined by its ability to neutralize VEGF-C. Results showed that an adenovirus expression vector for soluble VEGFR-3 was successfully constructed, which can produce high titer recombinant adenovirus containing VEGFR-3(1-3Ig) of BABL/c mouse in 293 cells after cotransfection with packing vector. On transfection with the recombinant adenovirus carrying VEGFR-3(1-3Ig), LEPCs can release soluble VEGFR-3 as determined by ELISA, and the released VEGFR-3 can neutralize VEGFC efficiently. In conlusion, we demonstrated that LEPCs can express and secrete soluble VEGFR-3 protein after transfected with recombinant adenovirus containing BABL/c mouse VEGFR-3(1-3Ig) gene, and the released soluble VEGFR-3 protein to neutralize VEGF-C, This study has laid a foundation for the application of VEGFR-3 gene-transfected LEPCs in the antitumor treatment.
【Key words】BABL/c mouse; VEGFR-3; Recombinant adenovirus; transfect; LEPCs

Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.4: 252-257

Effect of Tbx1 Knock-Down on the Expression of Tbx20 and Tbx2 in Zebrafish
ZHANG Li-feng1,2, GUI Yong-hao1,2, WANG Yue-xiang3, JIANG Qiu3,
SONG Hou-yan3
(1. Children’s Hospital of Fudan University, Shanghai 200032, China; 2. Department of Pediatrics; Shanghai Medical College of Fudan University, Shanghai, 200032; 3. Department of Molecular Genetics; Shanghai Medical School & Key Laboratory of Molecular Medicine, Ministry of Education, Fudan University, Shanghai 200032)

【Abstract】Objective Tbx1, one of the genes mapped within the del22q11 locus in human, is important for aortic arch formation and also contributes to the development of the outflow tract. Tbx1 currently represents the most promising candidate gene for DGS. The hierarchical interaction between different T-box genes was revealed as a central role of early heart patterning and morphogenesis. The aim of this study was to explore the effect of Tbx1 knock-down on the expressions of two other T-box genes, Tbx2 and Tbx20 in zebrafish. Methods Wild-type (AB* strain) zebrafish stocks were obtained from the International Zebrafish Research Center (IZRC). The following morpholino oligos (Gene Tools LLC, Corvallis, OR, USA) were designed against translational start codon, and the sequence was 5’CAGGTCGCGTTTAACATTTAGGTTA 3’.The positive control and standard control morpholino were designed for control microinjections. The morpholino oligos at the indicated concentrations were microinjected into single-to-four-cell stage zebrafish embryos. The RNA antisense probes of Tbx20, Bmp2b and Tbx2 used for in situ hybridization were prepared. Whole-mount in situ hybridization was used to monitor the expressions of Tbx20, Bmp2b and Tbx2. Stained embryos were examined with Olympus BX61 and SZX12 microscopes, and photographed with a DP70 digital camera. The control and experimental embryos were conducted in parallel. Results Tbx1 morpholino were injected into fertilized eggs in various doses to establish an optimal dose. Embryos presented a consistent phenotype with doses between 5~10 ngMO/embryo (57%, n = 100). While injection of the same amount of control-MO could not produce the specific effect, demonstrating that these results were not due to an injection artifact. Tbx1 morphant embryos were characterized by defects in the pharyngeal arches, otic vesicle, aortic arches and thymus. During zebrafish embryogenesis, the expression of Tbx20 was found in the anterior lateral plate mesoderm, the heart field, branchiomotor neuron, retina and the endothelium of the dorsal aorta. In Tbx1 morphant embryos, the expression of Tbx20 in the heart was strongly reduced at 25-somite stage when compared with control-MO embryos. From 24 hpf onwards, Tbx20 was strongly expressed throughout the linear heart tube, including outflow tract, ventricle, atrium and sinus vinous. At 48 hpf, the alterations of Tbx20 expression became more apparent in Tbx1 morphant embryos, serious down regulation in the branchiomotor neuron. Bmp2b was expressed in the pharyngeal pouches (1-5) and heart robustly at 48 hpf. The expression profile of Bmp2b was altered in Tbx1 morphant embryos. Bmp2b expression was severely down-regulated in Tbx1 morphant embryos at this stage. The expression of Bmp2b in posterior pharyngeal pouches was the most affected, and nearly absent, whereas the expression in the anterior pharyngeal pouches are slightly reduced. But the expression of Bmp2b was only slightly decreased in the heart region at 48 hpf when compared with the control-MO. From 20-somite to long-pec stage, Tbx2 continues to express in the pharyngeal arches and otic vesicle in zebrafish. Tbx2 is expressed overlapping with Tbx1 in the pharyngeal arches 3-7 and otic vesicle in zebrafish. We found that Tbx2 expressed in the ventral anterior diencephalons, posterior retina, otic vesicle, neural tube, retina and pharyngeal arches3-7 at 20-somite stage. The expression of Tbx2 was significantly reduced or absent in pharyngeal arches3-7 at 20-somite in Tbx1 morphant embryo. The difference becomes more apparent at prim-5 stage when compared to the control-MO embryos. The expression of Tbx2 was down regulated in posterior arches at 48 hpf in Tbx1 morphant embryos when compared with the control-MO embryos. In addition, Tbx2 expression domain was shrunk when compared with the control-MO embryos at the same stage. The altered expression of Tbx2 in the pharyngeal arches lasted till 72 hpf. The difference of Tbx2 expression was indistinguishable between Tbx1 morphant and control-MO embryos in the other regions. Conclusions Tbx1 morphant embryos show defects in the pharyngeal arches, otic vesicle, aortic arches and thymus. Tbx1 specific antisense morpholinos injections can successfully phenocopy the known loss-of-function phenotype of van gogh mutant. T-box genes may not function by themselves in the regulation of heart development, but may need to interact with other T-box transcriptional factors. Tbx1 may affect Bmp2b; secondarily affect the expression of Tbx20. Our results raise the possibility that there are relationships between Tbx1 and Tbx2 during pharyngeal arch development directly or indirectly. Our result suggested that Tbx1 may interact with other important T-box containing transcription factor, including Tbx20 and Tbx2.
【Keyword】 Tbx1; zebrafish; Bmp2b; Tbx20; Tbx2
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.5: 321-325

Establishment of a Guinea Pig Model of Myopia Induced by Exposing to 530 nm Monochromatic Light
QIAN Yi-feng,DAI Jin-hui,LIU Rui,CHU Ren-yuan
(Department of Ophthalmology, Eye and ENT Hospital, Fudan University, Shanghai 200031, China)
【Abstract】 Objective In early life period when eye grows rapidly, visual experience can play an important role in axial growth and refractive development. For instance, depriving the eye of form vision during infancy will accelerate axial growth, resulting in substantial amounts of myopia, called form deprivation myopia (FDM). Similarly, imposing the eye with a negative lens produces compensating myopic growth in many species, called defocus induced myopia (DIM). As one of the important visual experiences, color vision and its effects on eye growth deserve to be investigated. The purpose of this study was to investigate the effect of 530 nm monochromatic light and establish an innovative model of myopia in guinea pig by exposing to this monochromatic light. Methods Twenty male guinea pigs at 2 weeks old were randomly assigned to two groups (n = 10). The experimental group was raised under the condition of 530 nm monochromatic light illumination. The control one was bred under white light illumination with 5000 k color temperature. These guinea pigs were raised in a specially designed cage. The light source was provided by specially made LEDs (green: peak value 530 nm and half bandwidth 30 nm; white: color temperature 5000 K). The illuminative parameters of the two groups were identical and the light quantum number was 3×10-4μmol•cm-2•s-1. Through measuring, the irradiance value was 0.150 mW.cm-2 for green light and 0.247 mW.cm-2 for white light approximately. All animals were kept under a 12/12 h light/dark cycle (light: 8 a.m. ~ 8 p.m.), in the temperature of 22°C-26°C and a relative humidity of 55-65%. Both groups underwent biometric measurement including refraction, corneal curvature and axial length, etc. before and after twelve-week treatment. The refraction was examined using a streak retinoscope and trial lenses in a dark room one hour after topically administering a cycloplegic eye drop. The radius of corneal curvature was measured with a keratometry (Topcon OM-4, Japan) and axial components was measured by an A-scan ultrasonagraphy (Opticon Hiscan A/B). Repeated measurements were undertaken. Only the right eye’s parameters of each guinea pig were used to analysis. Unpaired t-tests were used in all comparisons between the two groups of eyes with a statistical analysis software (Stata, version 7.0). Results Before treatment, the refraction of experimental group was 4.6±0.59 D, and that of the control group was 4.63±0.48 D. The axial and vitreous body length was 7.48±0.11 mm and 3.16±0.07 mm in the experimental group, respectively, and 7.55±0.16 mm, 3.21±0.09 mm in the control. The differences between the biometric parameters of the two groups including refraction, corneal curvature and axial components were not significant (P>0.05). However, after twelve-week exposure, the variation of refraction in the experimental group was -3.125±0.76 D, and -1.075±0.71 D was observed in the control group. There was a 2.0 D myopia in the experimental group when compared with the control. Axial length grew 0.98±0.13 mm in the experimental group and 0.77±0.22 mm in the control. Vitreous body extended 0.33±0.14 mm and 0.13±0.14 mm in the two groups, respectively. The refraction of the experimental group shifted more towards myopia (P<0.0001) accompany with a more accelerated speed of axial growth and vitreous body’s extension (P<0.05) when compared with that of the control group. There were no significant differences in the radius of corneal curvature, the depth of anterior chamber and the lens thickness between the eyes of the two groups at the end of the investigation (P>0.05). Conclusion 530 nm monochromatic light can accelerate the prolongation of axial length and vitreous body inducing axial myopia in guinea pigs.
【Key words】 Monochromatic light; Myopia; Animal model; guinea pig
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.6: 401-404


Establishment of a Myelin Basic Protein Fragment-Induced Wistar Rat Model of Autoimmune Encephalomyelitis
LI Bo, TAN Guo-jun, LIU Ning-ning, LIU Rui-chun
The Second Hospital of Hebei Medical University, Shijiazhuang 050000, China
【Abstract】Objective Multiple sclerosis (MS, also known as disseminated sclerosis) is an autoimmune disease of the central nervous system (CNS) in which the immune system attacks the CNS, leading to demyelination and characterized pathologically by accumulation of perivascular and parenchymal T lymphocyte (T cells) and macrophage infiltration associated with myelin destruction. MS lesions are also characterized by death of oligodendrocytes (the myelin-producing cells) and proliferation and hypertrophy of astrocytes with scar tissue (gliosis) replacing normal myelin. These changes result in the loss of axonal conduction of the CNS neurons and clinical disability. Multiple sclerosis, with the feature of recurrent attacks, is one of momentous diseases of nervous system for its high incidence, puber-attaching and chronic course. Due to the shortage of data from MS patients, the establishment of an ideal animal model of MS is of fundamental importance for further studies on the pathogenesis and therapy of this disease. Experimental autoimmune encephalomyelitis(EAE), also named experimental allergic encephalomyelitis (EAE), is an autoimmune disease, characterized by and perivascular cuffings in the CNS. EAE, induced in the rats by immunization with encephalitogen (i e. spinal cord homogenate, and myelin proteins) in combination with complete Freund's adjuvant (CFA) or by adoptive transfer of MBP-specific T cells, is a widely used model for multiple sclerosis (MS) based on autoimmune, histopathological, genetic and clinical similarities. The orthodox experimental autoimmune encephalomyelitis model was induced by guinea pig spinal cord homogenate (GPSCH), but the complexity of the antigen or amino acid components of GPSCH limited the further studies of EAE and MS on the molecular level.
So, we would suppose that using myelin protein fragment as an alternative to induce EAE model and to lay the foundation for further study the encephalitogenic role of a specific antigenic component of spinal cord and its quantitative effects on EAE. The aim of this study is to test our hypothesis.
Methods
Animals: Female 6-8 week-old Wistar rats (200±20 g) were purchased from the Experimental Animal Center of Hebei Medical University (Grade: II; Number: SCXK 2003-1-003), housed in the animal center in the Second Hospital of Hebei Medical University and used according to the institutional guidelines.
Preparation for immunizing antigen: MBP69-85 dissolved in normal saline was mixed with the same volume of complete Freund’s adjuvant (CFA) to prepare the encephalitogenic emulsion. The complete Freund’s adjuvant was prepared with different concentration of Bacille Calmette-Guerin.
The rats grouping and EAE induction; Totally 70 Wistar rats were included in this experiment. Ten out of the 70 rats were chosen as a control group, the other rats were divided equally and randomly into three groups: group A, B and C, according to the difference of the encephalitogenic emulsion. Rats in the group A were immunized with 50 g MBP69-85 + CFA (6 mg BCG);Rats in the group B were immunized with 25 g MBP69-85 + CFA (6 mg BCG);Rats in the group C were immunized with 25g MBP69-85 + CFA(12 mg BCG). Each rat was immunized with 0.5 mL encephalitogenic emulsion, hypodermic injection in five points in foot pads and the back.
Clinical assessment of EAE:The animals were housed in plastic cages in a room and given commercial food and water ad libitum. The clinical signs of EAE include changes of mental state, loss of body weight, loss of tail tone, limb paralysis and moribund (or death). The animals that appear one of the clinical signs were considered as EAE positive. Individual rats were examined daily for clinical signs of neurological deficits scored on a 0-5 scale as follows: 1, tail weakness; 2, tail weakness plus limb asthenia; 3, mild limb paralysis; 4, severe limb paralysis; 5, moribund/death.
Histopathology: The rats in each group were sacrificed after anesthesia with intraperitoneal injection of 10% chloralhydrate at 30 days after immunization. Tissues of the brain and spinal cord were removed after left ventricle perfusion with normal saline and 4% paraform and fixed in 4% paraformaldyhyde in 0.2 mol/L PBS(PH 7.2) at 4°C overnight, washed in PBS, dehydrated in a graded ethanol series, and then the samples were embedded in paraffin and sectioned at 6 µm thickness. The sections were stained with HE staining, trichrome staining and immunohistochemistry of MBP (myelin basic protein) and NF (neurofilament).
Results
The clinical signs and scoring of EAE rats: Experimental rats were immunized on day 0. After immunization, all animals gradually became inactive. Appetite decreased and there was a substantial reduction in body weight, while fur loses its smoothness and gloss. Some of the Wistar rats immunized with 50 g MBP69-85 showed disorders 12~16 days after immunization. The clinical symptoms included acratia of tail, paralysis of tail and limbs, gatism, head tilt, spasticity or moribund (or death). The EAE incidence in the rats was 30%. Among the 6 EAE rats, two showed head tilt, occurred at 13 days and 15 days after immunization, respectively. The average clinical scores were 2.38 ± 1.89 (the two rats with head tilt were not included). The average time of onset was 13.83 ± 1.47 days. The course of EAE was usually monophasic with spontaneous remission in a few days after onset (2 to 5 days). The rats in other groups showed no disorder within the observation period.
Histopathologic examination:HE staining: There was inflammatory cell infiltration in nervous tissue and
perivascular cuffings in the junctional zone of gray and white matters at the acute phase of the disease. Immunohistochemistry: The immunohistochemistry of MBP: There was partial myelin disaggregation and even extensive spongiform vacuolization in the white matter, and disarrangement, disaggregation and loss of MBP in the grey matter. The immunohistochemistry of NF: The axons were with anisochromia, swelling, beaded-discontinuity and disruption.
Conclusions
To some extent, the success of establishment of rat model of EAE is dependent on the dose of immunizing antigen MBP69-85. The onset of the disease needs a properly selected dose of immunizing antigen. BCG in the complete Freund’s adjuvant is not a major cause in the induction of the experimental autoimmune encephalomyelitis. This Wistar rat model of experimental autoimmune encephalomyelitis induced by fragments of myelin basic protein 9 (MBP69-85) show typical clinical symptoms and pathological changes of multiple sclerosis, and is a reliable animal model for further studies of pathogenesis and treatment of multiple sclerosis.
【Key words】 Autoimmunity;Encephalomyelitis;Multiple sclerosis;Myelin basic protein;Neurofilament;Bacille Calmette-Guerin
Acta Lab Anim Sci Sin,June, 2009,Vol.17. No.6: 405-408

【收藏】 【打印】 【关闭】